ID: 985194854

View in Genome Browser
Species Human (GRCh38)
Location 4:187418914-187418936
Sequence GAGGCTGGACAATTTCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985194854_985194856 -9 Left 985194854 4:187418914-187418936 CCCAGATGAAATTGTCCAGCCTC No data
Right 985194856 4:187418928-187418950 TCCAGCCTCATGTGAATCGACGG No data
985194854_985194860 24 Left 985194854 4:187418914-187418936 CCCAGATGAAATTGTCCAGCCTC No data
Right 985194860 4:187418961-187418983 AGCTGTGCCGCCCATTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985194854 Original CRISPR GAGGCTGGACAATTTCATCT GGG (reversed) Intergenic
No off target data available for this crispr