ID: 985198164

View in Genome Browser
Species Human (GRCh38)
Location 4:187455539-187455561
Sequence CATTTCCCATTTCAGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985198161_985198164 5 Left 985198161 4:187455511-187455533 CCTGTTGCATTTAATTGCATAAT No data
Right 985198164 4:187455539-187455561 CATTTCCCATTTCAGTTTTATGG No data
985198160_985198164 30 Left 985198160 4:187455486-187455508 CCTGTGCGTGTATAATGCATGAA No data
Right 985198164 4:187455539-187455561 CATTTCCCATTTCAGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985198164 Original CRISPR CATTTCCCATTTCAGTTTTA TGG Intergenic
No off target data available for this crispr