ID: 985198380

View in Genome Browser
Species Human (GRCh38)
Location 4:187458447-187458469
Sequence TTGGGTAATTAGATGTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985198380_985198387 19 Left 985198380 4:187458447-187458469 CCATCATACATCTAATTACCCAA No data
Right 985198387 4:187458489-187458511 TTTTTTTGTTTTTTTGAAACAGG 0: 6
1: 613
2: 16419
3: 24180
4: 51679
985198380_985198388 20 Left 985198380 4:187458447-187458469 CCATCATACATCTAATTACCCAA No data
Right 985198388 4:187458490-187458512 TTTTTTGTTTTTTTGAAACAGGG 0: 10
1: 812
2: 17033
3: 24085
4: 49944
985198380_985198383 -6 Left 985198380 4:187458447-187458469 CCATCATACATCTAATTACCCAA No data
Right 985198383 4:187458464-187458486 ACCCAACCAGTCAGGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985198380 Original CRISPR TTGGGTAATTAGATGTATGA TGG (reversed) Intergenic
No off target data available for this crispr