ID: 985199943

View in Genome Browser
Species Human (GRCh38)
Location 4:187474470-187474492
Sequence CTTCACTGCACCCTGGCTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985199939_985199943 -3 Left 985199939 4:187474450-187474472 CCGCAGTGGCCCTGTCAGTTCTT No data
Right 985199943 4:187474470-187474492 CTTCACTGCACCCTGGCTGTCGG No data
985199936_985199943 23 Left 985199936 4:187474424-187474446 CCCAAACTACATTATTTCAGGCA No data
Right 985199943 4:187474470-187474492 CTTCACTGCACCCTGGCTGTCGG No data
985199937_985199943 22 Left 985199937 4:187474425-187474447 CCAAACTACATTATTTCAGGCAC No data
Right 985199943 4:187474470-187474492 CTTCACTGCACCCTGGCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985199943 Original CRISPR CTTCACTGCACCCTGGCTGT CGG Intergenic
No off target data available for this crispr