ID: 985201010

View in Genome Browser
Species Human (GRCh38)
Location 4:187485624-187485646
Sequence CCTGTAATCCAGGAGCTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985201010_985201016 29 Left 985201010 4:187485624-187485646 CCTTGTAGCTCCTGGATTACAGG No data
Right 985201016 4:187485676-187485698 AAATTTCCCCTTCCAGGAATTGG No data
985201010_985201015 23 Left 985201010 4:187485624-187485646 CCTTGTAGCTCCTGGATTACAGG No data
Right 985201015 4:187485670-187485692 GATAACAAATTTCCCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985201010 Original CRISPR CCTGTAATCCAGGAGCTACA AGG (reversed) Intergenic
No off target data available for this crispr