ID: 985203322

View in Genome Browser
Species Human (GRCh38)
Location 4:187506021-187506043
Sequence GCTGCCTGCCAGTCCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985203322_985203327 10 Left 985203322 4:187506021-187506043 CCGGCGCGGGACTGGCAGGCAGC No data
Right 985203327 4:187506054-187506076 GCCCCTGTGCGGGATCCACTGGG 0: 41
1: 423
2: 623
3: 531
4: 370
985203322_985203324 0 Left 985203322 4:187506021-187506043 CCGGCGCGGGACTGGCAGGCAGC No data
Right 985203324 4:187506044-187506066 TGCACCTGCAGCCCCTGTGCGGG No data
985203322_985203332 24 Left 985203322 4:187506021-187506043 CCGGCGCGGGACTGGCAGGCAGC No data
Right 985203332 4:187506068-187506090 TCCACTGGGTGAAGCCAGCTGGG 0: 849
1: 786
2: 340
3: 179
4: 241
985203322_985203323 -1 Left 985203322 4:187506021-187506043 CCGGCGCGGGACTGGCAGGCAGC No data
Right 985203323 4:187506043-187506065 CTGCACCTGCAGCCCCTGTGCGG No data
985203322_985203326 9 Left 985203322 4:187506021-187506043 CCGGCGCGGGACTGGCAGGCAGC No data
Right 985203326 4:187506053-187506075 AGCCCCTGTGCGGGATCCACTGG 0: 24
1: 221
2: 409
3: 327
4: 334
985203322_985203331 23 Left 985203322 4:187506021-187506043 CCGGCGCGGGACTGGCAGGCAGC No data
Right 985203331 4:187506067-187506089 ATCCACTGGGTGAAGCCAGCTGG 0: 862
1: 802
2: 346
3: 181
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985203322 Original CRISPR GCTGCCTGCCAGTCCCGCGC CGG (reversed) Intergenic
No off target data available for this crispr