ID: 985207821

View in Genome Browser
Species Human (GRCh38)
Location 4:187559376-187559398
Sequence CTGATCATATGTAAGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985207818_985207821 18 Left 985207818 4:187559335-187559357 CCACTTCACTGTTATTTGTTTTT No data
Right 985207821 4:187559376-187559398 CTGATCATATGTAAGATCAAAGG No data
985207819_985207821 -5 Left 985207819 4:187559358-187559380 CCACTTAATTTACCTGTTCTGAT No data
Right 985207821 4:187559376-187559398 CTGATCATATGTAAGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985207821 Original CRISPR CTGATCATATGTAAGATCAA AGG Intergenic
No off target data available for this crispr