ID: 985209061

View in Genome Browser
Species Human (GRCh38)
Location 4:187572545-187572567
Sequence TAGCCAGGGCTGCCCTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985209061_985209071 11 Left 985209061 4:187572545-187572567 CCACTGAAGGGCAGCCCTGGCTA No data
Right 985209071 4:187572579-187572601 ACCCTGGATAAGAGTGGGCAGGG No data
985209061_985209076 16 Left 985209061 4:187572545-187572567 CCACTGAAGGGCAGCCCTGGCTA No data
Right 985209076 4:187572584-187572606 GGATAAGAGTGGGCAGGGAGGGG No data
985209061_985209075 15 Left 985209061 4:187572545-187572567 CCACTGAAGGGCAGCCCTGGCTA No data
Right 985209075 4:187572583-187572605 TGGATAAGAGTGGGCAGGGAGGG No data
985209061_985209078 27 Left 985209061 4:187572545-187572567 CCACTGAAGGGCAGCCCTGGCTA No data
Right 985209078 4:187572595-187572617 GGCAGGGAGGGGGATCTCTGAGG No data
985209061_985209079 28 Left 985209061 4:187572545-187572567 CCACTGAAGGGCAGCCCTGGCTA No data
Right 985209079 4:187572596-187572618 GCAGGGAGGGGGATCTCTGAGGG No data
985209061_985209074 14 Left 985209061 4:187572545-187572567 CCACTGAAGGGCAGCCCTGGCTA No data
Right 985209074 4:187572582-187572604 CTGGATAAGAGTGGGCAGGGAGG No data
985209061_985209070 10 Left 985209061 4:187572545-187572567 CCACTGAAGGGCAGCCCTGGCTA No data
Right 985209070 4:187572578-187572600 AACCCTGGATAAGAGTGGGCAGG No data
985209061_985209077 17 Left 985209061 4:187572545-187572567 CCACTGAAGGGCAGCCCTGGCTA No data
Right 985209077 4:187572585-187572607 GATAAGAGTGGGCAGGGAGGGGG No data
985209061_985209069 6 Left 985209061 4:187572545-187572567 CCACTGAAGGGCAGCCCTGGCTA No data
Right 985209069 4:187572574-187572596 GGATAACCCTGGATAAGAGTGGG No data
985209061_985209068 5 Left 985209061 4:187572545-187572567 CCACTGAAGGGCAGCCCTGGCTA No data
Right 985209068 4:187572573-187572595 GGGATAACCCTGGATAAGAGTGG No data
985209061_985209067 -5 Left 985209061 4:187572545-187572567 CCACTGAAGGGCAGCCCTGGCTA No data
Right 985209067 4:187572563-187572585 GGCTAGAGGTGGGATAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985209061 Original CRISPR TAGCCAGGGCTGCCCTTCAG TGG (reversed) Intergenic
No off target data available for this crispr