ID: 985212187

View in Genome Browser
Species Human (GRCh38)
Location 4:187607086-187607108
Sequence GGTTCTTATGGAGGAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985212183_985212187 -10 Left 985212183 4:187607073-187607095 CCACTGAATGTATGGTTCTTATG No data
Right 985212187 4:187607086-187607108 GGTTCTTATGGAGGAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985212187 Original CRISPR GGTTCTTATGGAGGAGAGGC TGG Intergenic
No off target data available for this crispr