ID: 985222157

View in Genome Browser
Species Human (GRCh38)
Location 4:187718472-187718494
Sequence GATGACACAAAATGCCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985222157_985222158 8 Left 985222157 4:187718472-187718494 CCTAGATGGCATTTTGTGTCATC No data
Right 985222158 4:187718503-187718525 TAAGTGCCTCTTAATACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985222157 Original CRISPR GATGACACAAAATGCCATCT AGG (reversed) Intergenic
No off target data available for this crispr