ID: 985222158

View in Genome Browser
Species Human (GRCh38)
Location 4:187718503-187718525
Sequence TAAGTGCCTCTTAATACTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985222156_985222158 9 Left 985222156 4:187718471-187718493 CCCTAGATGGCATTTTGTGTCAT No data
Right 985222158 4:187718503-187718525 TAAGTGCCTCTTAATACTCTTGG No data
985222157_985222158 8 Left 985222157 4:187718472-187718494 CCTAGATGGCATTTTGTGTCATC No data
Right 985222158 4:187718503-187718525 TAAGTGCCTCTTAATACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985222158 Original CRISPR TAAGTGCCTCTTAATACTCT TGG Intergenic
No off target data available for this crispr