ID: 985226354

View in Genome Browser
Species Human (GRCh38)
Location 4:187765516-187765538
Sequence CAGCTAACAGTAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985226354_985226360 13 Left 985226354 4:187765516-187765538 CCATCCACCACTACTGTTAGCTG No data
Right 985226360 4:187765552-187765574 GCTGCTGACTCCCATCCCTCCGG No data
985226354_985226362 23 Left 985226354 4:187765516-187765538 CCATCCACCACTACTGTTAGCTG No data
Right 985226362 4:187765562-187765584 CCCATCCCTCCGGATCCAGCAGG 0: 6
1: 21
2: 86
3: 131
4: 251
985226354_985226364 24 Left 985226354 4:187765516-187765538 CCATCCACCACTACTGTTAGCTG No data
Right 985226364 4:187765563-187765585 CCATCCCTCCGGATCCAGCAGGG 0: 20
1: 71
2: 130
3: 138
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985226354 Original CRISPR CAGCTAACAGTAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr