ID: 985231655

View in Genome Browser
Species Human (GRCh38)
Location 4:187824694-187824716
Sequence GCTGCTTGTTATCTCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985231649_985231655 23 Left 985231649 4:187824648-187824670 CCACAGAGCTGGGATTCAGATTT No data
Right 985231655 4:187824694-187824716 GCTGCTTGTTATCTCCAAGCTGG No data
985231647_985231655 25 Left 985231647 4:187824646-187824668 CCCCACAGAGCTGGGATTCAGAT No data
Right 985231655 4:187824694-187824716 GCTGCTTGTTATCTCCAAGCTGG No data
985231648_985231655 24 Left 985231648 4:187824647-187824669 CCCACAGAGCTGGGATTCAGATT No data
Right 985231655 4:187824694-187824716 GCTGCTTGTTATCTCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985231655 Original CRISPR GCTGCTTGTTATCTCCAAGC TGG Intergenic
No off target data available for this crispr