ID: 985233482

View in Genome Browser
Species Human (GRCh38)
Location 4:187847514-187847536
Sequence GATCTCAGAGAACCACAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985233482_985233484 4 Left 985233482 4:187847514-187847536 CCCAGTTGTGGTTCTCTGAGATC No data
Right 985233484 4:187847541-187847563 TTTCTTACTTGATTAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985233482 Original CRISPR GATCTCAGAGAACCACAACT GGG (reversed) Intergenic
No off target data available for this crispr