ID: 985234757

View in Genome Browser
Species Human (GRCh38)
Location 4:187860941-187860963
Sequence CTCTTTTAGGGCATGCTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985234751_985234757 2 Left 985234751 4:187860916-187860938 CCATGTTTAGTGCTTCCTTCAGG 0: 4668
1: 4230
2: 2042
3: 858
4: 703
Right 985234757 4:187860941-187860963 CTCTTTTAGGGCATGCTCGGTGG No data
985234749_985234757 16 Left 985234749 4:187860902-187860924 CCGGTTGTTCCTTTCCATGTTTA 0: 3944
1: 1849
2: 1027
3: 545
4: 546
Right 985234757 4:187860941-187860963 CTCTTTTAGGGCATGCTCGGTGG No data
985234750_985234757 7 Left 985234750 4:187860911-187860933 CCTTTCCATGTTTAGTGCTTCCT 0: 4523
1: 4061
2: 1998
3: 833
4: 631
Right 985234757 4:187860941-187860963 CTCTTTTAGGGCATGCTCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985234757 Original CRISPR CTCTTTTAGGGCATGCTCGG TGG Intergenic
No off target data available for this crispr