ID: 985236354

View in Genome Browser
Species Human (GRCh38)
Location 4:187879246-187879268
Sequence CAGGCACATTTTGCAGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985236354_985236357 -2 Left 985236354 4:187879246-187879268 CCCACTACTGCAAAATGTGCCTG No data
Right 985236357 4:187879267-187879289 TGCTTGCTATAAACAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985236354 Original CRISPR CAGGCACATTTTGCAGTAGT GGG (reversed) Intergenic
No off target data available for this crispr