ID: 985237498

View in Genome Browser
Species Human (GRCh38)
Location 4:187892012-187892034
Sequence ATGGATAAGTAGACAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985237493_985237498 25 Left 985237493 4:187891964-187891986 CCTGGGCGACAGAGCCAGACTCC 0: 964
1: 32869
2: 86251
3: 131983
4: 146364
Right 985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG No data
985237494_985237498 11 Left 985237494 4:187891978-187892000 CCAGACTCCGTCTCAAAACAAAA 0: 31
1: 1186
2: 3179
3: 3913
4: 4184
Right 985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG No data
985237492_985237498 29 Left 985237492 4:187891960-187891982 CCAGCCTGGGCGACAGAGCCAGA 0: 1687
1: 49225
2: 143194
3: 197819
4: 176370
Right 985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG No data
985237495_985237498 4 Left 985237495 4:187891985-187892007 CCGTCTCAAAACAAAACAAAAAG 0: 20
1: 440
2: 10527
3: 102851
4: 79969
Right 985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985237498 Original CRISPR ATGGATAAGTAGACAGAGGA AGG Intergenic
No off target data available for this crispr