ID: 985244026

View in Genome Browser
Species Human (GRCh38)
Location 4:187961359-187961381
Sequence ACATTATCCCCACTCCCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985244024_985244026 23 Left 985244024 4:187961313-187961335 CCACAGTTCAAATCTGAGGTAAC No data
Right 985244026 4:187961359-187961381 ACATTATCCCCACTCCCTTAAGG No data
985244022_985244026 30 Left 985244022 4:187961306-187961328 CCTTGTTCCACAGTTCAAATCTG No data
Right 985244026 4:187961359-187961381 ACATTATCCCCACTCCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985244026 Original CRISPR ACATTATCCCCACTCCCTTA AGG Intergenic