ID: 985252325

View in Genome Browser
Species Human (GRCh38)
Location 4:188036374-188036396
Sequence CTGGGGAGGCTGAGGTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985252315_985252325 12 Left 985252315 4:188036339-188036361 CCAGGTGTGGTGGCTCGCACCTG 0: 65
1: 5740
2: 31134
3: 99321
4: 203713
Right 985252325 4:188036374-188036396 CTGGGGAGGCTGAGGTAGGAGGG No data
985252319_985252325 -7 Left 985252319 4:188036358-188036380 CCTGTAATGCCAGCTACTGGGGA 0: 37
1: 5135
2: 114343
3: 264021
4: 240831
Right 985252325 4:188036374-188036396 CTGGGGAGGCTGAGGTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985252325 Original CRISPR CTGGGGAGGCTGAGGTAGGA GGG Intergenic
No off target data available for this crispr