ID: 985260689

View in Genome Browser
Species Human (GRCh38)
Location 4:188112191-188112213
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985260684_985260689 -6 Left 985260684 4:188112174-188112196 CCTTTTCTCCAAGGCTGCTCCAT No data
Right 985260689 4:188112191-188112213 CTCCATTAGAAGCAGGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr