ID: 985262983

View in Genome Browser
Species Human (GRCh38)
Location 4:188132004-188132026
Sequence ACTCAGAAGCAGAAAGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985262983_985262988 17 Left 985262983 4:188132004-188132026 CCTTCTACTTTCTGCTTCTGAGT No data
Right 985262988 4:188132044-188132066 CTTGTAGAAGGGGAATCATGTGG No data
985262983_985262984 -9 Left 985262983 4:188132004-188132026 CCTTCTACTTTCTGCTTCTGAGT No data
Right 985262984 4:188132018-188132040 CTTCTGAGTTTGACTATGTCAGG No data
985262983_985262987 7 Left 985262983 4:188132004-188132026 CCTTCTACTTTCTGCTTCTGAGT No data
Right 985262987 4:188132034-188132056 TGTCAGGTAACTTGTAGAAGGGG No data
985262983_985262986 6 Left 985262983 4:188132004-188132026 CCTTCTACTTTCTGCTTCTGAGT No data
Right 985262986 4:188132033-188132055 ATGTCAGGTAACTTGTAGAAGGG No data
985262983_985262985 5 Left 985262983 4:188132004-188132026 CCTTCTACTTTCTGCTTCTGAGT No data
Right 985262985 4:188132032-188132054 TATGTCAGGTAACTTGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985262983 Original CRISPR ACTCAGAAGCAGAAAGTAGA AGG (reversed) Intergenic
No off target data available for this crispr