ID: 985267466

View in Genome Browser
Species Human (GRCh38)
Location 4:188163379-188163401
Sequence CTGTTGGCCTAGAACTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985267458_985267466 28 Left 985267458 4:188163328-188163350 CCTCCAATTCTACAAAAATAAAA No data
Right 985267466 4:188163379-188163401 CTGTTGGCCTAGAACTCAGGAGG No data
985267459_985267466 25 Left 985267459 4:188163331-188163353 CCAATTCTACAAAAATAAAATAT No data
Right 985267466 4:188163379-188163401 CTGTTGGCCTAGAACTCAGGAGG No data
985267462_985267466 -3 Left 985267462 4:188163359-188163381 CCGGCTGTTGCGGCACATGCCTG No data
Right 985267466 4:188163379-188163401 CTGTTGGCCTAGAACTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985267466 Original CRISPR CTGTTGGCCTAGAACTCAGG AGG Intergenic
No off target data available for this crispr