ID: 985267975

View in Genome Browser
Species Human (GRCh38)
Location 4:188167638-188167660
Sequence ACGATGGCCCAGGAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985267968_985267975 14 Left 985267968 4:188167601-188167623 CCCACACTCAACAGCAACACAGC No data
Right 985267975 4:188167638-188167660 ACGATGGCCCAGGAGGAGAGAGG No data
985267969_985267975 13 Left 985267969 4:188167602-188167624 CCACACTCAACAGCAACACAGCT No data
Right 985267975 4:188167638-188167660 ACGATGGCCCAGGAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985267975 Original CRISPR ACGATGGCCCAGGAGGAGAG AGG Intergenic
No off target data available for this crispr