ID: 985268041

View in Genome Browser
Species Human (GRCh38)
Location 4:188168123-188168145
Sequence CAATGTGAGCAGTGTGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985268039_985268041 0 Left 985268039 4:188168100-188168122 CCAAACAGGAACTTGTGCCTGAT No data
Right 985268041 4:188168123-188168145 CAATGTGAGCAGTGTGAATTTGG No data
985268038_985268041 1 Left 985268038 4:188168099-188168121 CCCAAACAGGAACTTGTGCCTGA No data
Right 985268041 4:188168123-188168145 CAATGTGAGCAGTGTGAATTTGG No data
985268037_985268041 2 Left 985268037 4:188168098-188168120 CCCCAAACAGGAACTTGTGCCTG No data
Right 985268041 4:188168123-188168145 CAATGTGAGCAGTGTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985268041 Original CRISPR CAATGTGAGCAGTGTGAATT TGG Intergenic
No off target data available for this crispr