ID: 985272130

View in Genome Browser
Species Human (GRCh38)
Location 4:188203614-188203636
Sequence GCAGAATTATGGGCCGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985272130_985272135 3 Left 985272130 4:188203614-188203636 CCGCGCCCGGCCCATAATTCTGC No data
Right 985272135 4:188203640-188203662 TTAAGCCTTCCCTTACAGCCAGG No data
985272130_985272136 4 Left 985272130 4:188203614-188203636 CCGCGCCCGGCCCATAATTCTGC No data
Right 985272136 4:188203641-188203663 TAAGCCTTCCCTTACAGCCAGGG No data
985272130_985272140 18 Left 985272130 4:188203614-188203636 CCGCGCCCGGCCCATAATTCTGC No data
Right 985272140 4:188203655-188203677 CAGCCAGGGAGTTACAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985272130 Original CRISPR GCAGAATTATGGGCCGGGCG CGG (reversed) Intergenic
No off target data available for this crispr