ID: 985274546

View in Genome Browser
Species Human (GRCh38)
Location 4:188225096-188225118
Sequence CTCACTTTTCCTGAGATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985274546_985274548 9 Left 985274546 4:188225096-188225118 CCTTACATCTCAGGAAAAGTGAG No data
Right 985274548 4:188225128-188225150 TTCCTAAATTCATTCCTTCATGG No data
985274546_985274550 21 Left 985274546 4:188225096-188225118 CCTTACATCTCAGGAAAAGTGAG No data
Right 985274550 4:188225140-188225162 TTCCTTCATGGATGTTGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985274546 Original CRISPR CTCACTTTTCCTGAGATGTA AGG (reversed) Intergenic
No off target data available for this crispr