ID: 985274550

View in Genome Browser
Species Human (GRCh38)
Location 4:188225140-188225162
Sequence TTCCTTCATGGATGTTGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985274546_985274550 21 Left 985274546 4:188225096-188225118 CCTTACATCTCAGGAAAAGTGAG No data
Right 985274550 4:188225140-188225162 TTCCTTCATGGATGTTGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985274550 Original CRISPR TTCCTTCATGGATGTTGTGC CGG Intergenic
No off target data available for this crispr