ID: 985282488

View in Genome Browser
Species Human (GRCh38)
Location 4:188301098-188301120
Sequence ACAAGGGTGGGGCCCCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985282488_985282495 9 Left 985282488 4:188301098-188301120 CCATTGAGGGGCCCCACCCTTGT No data
Right 985282495 4:188301130-188301152 TAACCCAAATTACCTCCCAAAGG No data
985282488_985282501 29 Left 985282488 4:188301098-188301120 CCATTGAGGGGCCCCACCCTTGT No data
Right 985282501 4:188301150-188301172 AGGCCTCACCTCTATCAAAATGG No data
985282488_985282502 30 Left 985282488 4:188301098-188301120 CCATTGAGGGGCCCCACCCTTGT No data
Right 985282502 4:188301151-188301173 GGCCTCACCTCTATCAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985282488 Original CRISPR ACAAGGGTGGGGCCCCTCAA TGG (reversed) Intergenic
No off target data available for this crispr