ID: 985285794 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:188335556-188335578 |
| Sequence | TTGGATACAGAAATCACACA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985285792_985285794 | -5 | Left | 985285792 | 4:188335538-188335560 | CCAAGAAACTAACACCATTTGGA | No data | ||
| Right | 985285794 | 4:188335556-188335578 | TTGGATACAGAAATCACACAAGG | No data | ||||
| 985285787_985285794 | 28 | Left | 985285787 | 4:188335505-188335527 | CCTGTGAGAGAGCTGATCAATGG | No data | ||
| Right | 985285794 | 4:188335556-188335578 | TTGGATACAGAAATCACACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985285794 | Original CRISPR | TTGGATACAGAAATCACACA AGG | Intergenic | ||
| No off target data available for this crispr | |||||