ID: 985285794

View in Genome Browser
Species Human (GRCh38)
Location 4:188335556-188335578
Sequence TTGGATACAGAAATCACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985285792_985285794 -5 Left 985285792 4:188335538-188335560 CCAAGAAACTAACACCATTTGGA No data
Right 985285794 4:188335556-188335578 TTGGATACAGAAATCACACAAGG No data
985285787_985285794 28 Left 985285787 4:188335505-188335527 CCTGTGAGAGAGCTGATCAATGG No data
Right 985285794 4:188335556-188335578 TTGGATACAGAAATCACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985285794 Original CRISPR TTGGATACAGAAATCACACA AGG Intergenic
No off target data available for this crispr