ID: 985288132

View in Genome Browser
Species Human (GRCh38)
Location 4:188357952-188357974
Sequence TAACTCACCTTGCCTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985288132_985288134 5 Left 985288132 4:188357952-188357974 CCTGTTTCAGGCAAGGTGAGTTA No data
Right 985288134 4:188357980-188358002 ACAGTGAGCTCCGCCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985288132 Original CRISPR TAACTCACCTTGCCTGAAAC AGG (reversed) Intergenic
No off target data available for this crispr