ID: 985294569

View in Genome Browser
Species Human (GRCh38)
Location 4:188421944-188421966
Sequence AACTCTAGGCCACAGGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985294564_985294569 20 Left 985294564 4:188421901-188421923 CCATTCTCAGGGGTCTGGCTTTA No data
Right 985294569 4:188421944-188421966 AACTCTAGGCCACAGGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985294569 Original CRISPR AACTCTAGGCCACAGGACAC TGG Intergenic