ID: 985296779

View in Genome Browser
Species Human (GRCh38)
Location 4:188444661-188444683
Sequence AAGCTCTACAAAGCACAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985296775_985296779 17 Left 985296775 4:188444621-188444643 CCATAAGCACCATACAATTGAGC No data
Right 985296779 4:188444661-188444683 AAGCTCTACAAAGCACAGGTTGG No data
985296777_985296779 8 Left 985296777 4:188444630-188444652 CCATACAATTGAGCAAGGTTGCA No data
Right 985296779 4:188444661-188444683 AAGCTCTACAAAGCACAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985296779 Original CRISPR AAGCTCTACAAAGCACAGGT TGG Intergenic
No off target data available for this crispr