ID: 985297888

View in Genome Browser
Species Human (GRCh38)
Location 4:188455185-188455207
Sequence ACACCTTGGGTGCCTCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985297883_985297888 15 Left 985297883 4:188455147-188455169 CCATAACATGTACTATTGAAATG No data
Right 985297888 4:188455185-188455207 ACACCTTGGGTGCCTCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985297888 Original CRISPR ACACCTTGGGTGCCTCAAGC TGG Intergenic
No off target data available for this crispr