ID: 985302009

View in Genome Browser
Species Human (GRCh38)
Location 4:188500092-188500114
Sequence GTGGCATTCCCGTCTGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985302009_985302013 18 Left 985302009 4:188500092-188500114 CCCATGTCAGACGGGAATGCCAC No data
Right 985302013 4:188500133-188500155 CAACAGTGGTAGTTTACTCCTGG No data
985302009_985302012 4 Left 985302009 4:188500092-188500114 CCCATGTCAGACGGGAATGCCAC No data
Right 985302012 4:188500119-188500141 TCACTTATTGATTTCAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985302009 Original CRISPR GTGGCATTCCCGTCTGACAT GGG (reversed) Intergenic
No off target data available for this crispr