ID: 985306693

View in Genome Browser
Species Human (GRCh38)
Location 4:188550320-188550342
Sequence CCTTGGTGGCATGTTTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985306693_985306702 13 Left 985306693 4:188550320-188550342 CCAGCATAAACATGCCACCAAGG No data
Right 985306702 4:188550356-188550378 TGTAAGGGTCAGACTGGTTAGGG No data
985306693_985306700 7 Left 985306693 4:188550320-188550342 CCAGCATAAACATGCCACCAAGG No data
Right 985306700 4:188550350-188550372 ACAAGGTGTAAGGGTCAGACTGG No data
985306693_985306695 -10 Left 985306693 4:188550320-188550342 CCAGCATAAACATGCCACCAAGG No data
Right 985306695 4:188550333-188550355 GCCACCAAGGTTGAGTAACAAGG No data
985306693_985306699 -2 Left 985306693 4:188550320-188550342 CCAGCATAAACATGCCACCAAGG No data
Right 985306699 4:188550341-188550363 GGTTGAGTAACAAGGTGTAAGGG No data
985306693_985306698 -3 Left 985306693 4:188550320-188550342 CCAGCATAAACATGCCACCAAGG No data
Right 985306698 4:188550340-188550362 AGGTTGAGTAACAAGGTGTAAGG No data
985306693_985306701 12 Left 985306693 4:188550320-188550342 CCAGCATAAACATGCCACCAAGG No data
Right 985306701 4:188550355-188550377 GTGTAAGGGTCAGACTGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985306693 Original CRISPR CCTTGGTGGCATGTTTATGC TGG (reversed) Intergenic
No off target data available for this crispr