ID: 985319122

View in Genome Browser
Species Human (GRCh38)
Location 4:188689161-188689183
Sequence TGATGTGTATGGGGGGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985319115_985319122 -8 Left 985319115 4:188689146-188689168 CCCACTAGAGAGTGATGATGTGT No data
Right 985319122 4:188689161-188689183 TGATGTGTATGGGGGGCATATGG No data
985319113_985319122 28 Left 985319113 4:188689110-188689132 CCATCTGGAAGAAAGTGCTACTA No data
Right 985319122 4:188689161-188689183 TGATGTGTATGGGGGGCATATGG No data
985319116_985319122 -9 Left 985319116 4:188689147-188689169 CCACTAGAGAGTGATGATGTGTA No data
Right 985319122 4:188689161-188689183 TGATGTGTATGGGGGGCATATGG No data
985319114_985319122 4 Left 985319114 4:188689134-188689156 CCATAAACTATTCCCACTAGAGA No data
Right 985319122 4:188689161-188689183 TGATGTGTATGGGGGGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985319122 Original CRISPR TGATGTGTATGGGGGGCATA TGG Intergenic
No off target data available for this crispr