ID: 985319436

View in Genome Browser
Species Human (GRCh38)
Location 4:188693265-188693287
Sequence GCAACAAGCTTCAGCTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985319436_985319441 25 Left 985319436 4:188693265-188693287 CCCAACAAGCTGAAGCTTGTTGC No data
Right 985319441 4:188693313-188693335 ATGTGCCCTGGTACACTGAAGGG No data
985319436_985319440 24 Left 985319436 4:188693265-188693287 CCCAACAAGCTGAAGCTTGTTGC No data
Right 985319440 4:188693312-188693334 AATGTGCCCTGGTACACTGAAGG No data
985319436_985319438 -7 Left 985319436 4:188693265-188693287 CCCAACAAGCTGAAGCTTGTTGC No data
Right 985319438 4:188693281-188693303 TTGTTGCTTGACTGAATTCTTGG No data
985319436_985319439 13 Left 985319436 4:188693265-188693287 CCCAACAAGCTGAAGCTTGTTGC No data
Right 985319439 4:188693301-188693323 TGGAGATAAAGAATGTGCCCTGG No data
985319436_985319442 26 Left 985319436 4:188693265-188693287 CCCAACAAGCTGAAGCTTGTTGC No data
Right 985319442 4:188693314-188693336 TGTGCCCTGGTACACTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985319436 Original CRISPR GCAACAAGCTTCAGCTTGTT GGG (reversed) Intergenic
No off target data available for this crispr