ID: 985319438

View in Genome Browser
Species Human (GRCh38)
Location 4:188693281-188693303
Sequence TTGTTGCTTGACTGAATTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985319435_985319438 16 Left 985319435 4:188693242-188693264 CCTAACTTTTTTTTTTTTCTTCT No data
Right 985319438 4:188693281-188693303 TTGTTGCTTGACTGAATTCTTGG No data
985319437_985319438 -8 Left 985319437 4:188693266-188693288 CCAACAAGCTGAAGCTTGTTGCT No data
Right 985319438 4:188693281-188693303 TTGTTGCTTGACTGAATTCTTGG No data
985319436_985319438 -7 Left 985319436 4:188693265-188693287 CCCAACAAGCTGAAGCTTGTTGC No data
Right 985319438 4:188693281-188693303 TTGTTGCTTGACTGAATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985319438 Original CRISPR TTGTTGCTTGACTGAATTCT TGG Intergenic
No off target data available for this crispr