ID: 985319441

View in Genome Browser
Species Human (GRCh38)
Location 4:188693313-188693335
Sequence ATGTGCCCTGGTACACTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985319437_985319441 24 Left 985319437 4:188693266-188693288 CCAACAAGCTGAAGCTTGTTGCT No data
Right 985319441 4:188693313-188693335 ATGTGCCCTGGTACACTGAAGGG No data
985319436_985319441 25 Left 985319436 4:188693265-188693287 CCCAACAAGCTGAAGCTTGTTGC No data
Right 985319441 4:188693313-188693335 ATGTGCCCTGGTACACTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985319441 Original CRISPR ATGTGCCCTGGTACACTGAA GGG Intergenic
No off target data available for this crispr