ID: 985321473

View in Genome Browser
Species Human (GRCh38)
Location 4:188716518-188716540
Sequence CAGTATGTTCATCTATAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985321473_985321477 -4 Left 985321473 4:188716518-188716540 CCATGTTATAGATGAACATACTG No data
Right 985321477 4:188716537-188716559 ACTGAGGCCCAGAGAGGACAGGG No data
985321473_985321475 -10 Left 985321473 4:188716518-188716540 CCATGTTATAGATGAACATACTG No data
Right 985321475 4:188716531-188716553 GAACATACTGAGGCCCAGAGAGG No data
985321473_985321476 -5 Left 985321473 4:188716518-188716540 CCATGTTATAGATGAACATACTG No data
Right 985321476 4:188716536-188716558 TACTGAGGCCCAGAGAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985321473 Original CRISPR CAGTATGTTCATCTATAACA TGG (reversed) Intergenic
No off target data available for this crispr