ID: 985322774

View in Genome Browser
Species Human (GRCh38)
Location 4:188733442-188733464
Sequence CCGCCGAGCCTGAGATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985322774_985322782 -2 Left 985322774 4:188733442-188733464 CCTGGAAATCTCAGGCTCGGCGG No data
Right 985322782 4:188733463-188733485 GGGGGAAATGGATACAGGTAGGG No data
985322774_985322784 27 Left 985322774 4:188733442-188733464 CCTGGAAATCTCAGGCTCGGCGG No data
Right 985322784 4:188733492-188733514 CCGTGTTCTTGCCGTGCAGCTGG No data
985322774_985322781 -3 Left 985322774 4:188733442-188733464 CCTGGAAATCTCAGGCTCGGCGG No data
Right 985322781 4:188733462-188733484 CGGGGGAAATGGATACAGGTAGG No data
985322774_985322780 -7 Left 985322774 4:188733442-188733464 CCTGGAAATCTCAGGCTCGGCGG No data
Right 985322780 4:188733458-188733480 TCGGCGGGGGAAATGGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985322774 Original CRISPR CCGCCGAGCCTGAGATTTCC AGG (reversed) Intergenic
No off target data available for this crispr