ID: 985322784

View in Genome Browser
Species Human (GRCh38)
Location 4:188733492-188733514
Sequence CCGTGTTCTTGCCGTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985322774_985322784 27 Left 985322774 4:188733442-188733464 CCTGGAAATCTCAGGCTCGGCGG No data
Right 985322784 4:188733492-188733514 CCGTGTTCTTGCCGTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985322784 Original CRISPR CCGTGTTCTTGCCGTGCAGC TGG Intergenic
No off target data available for this crispr