ID: 985323291

View in Genome Browser
Species Human (GRCh38)
Location 4:188738465-188738487
Sequence AGGTCCGCAAGGGCCCGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323291_985323296 -4 Left 985323291 4:188738465-188738487 CCGGGGCGGGCCCTTGCGGACCT No data
Right 985323296 4:188738484-188738506 ACCTTCCTCGAGCGCCAGGCGGG No data
985323291_985323302 21 Left 985323291 4:188738465-188738487 CCGGGGCGGGCCCTTGCGGACCT No data
Right 985323302 4:188738509-188738531 CTGAAGCCCATTTGAAGGTCAGG No data
985323291_985323294 -8 Left 985323291 4:188738465-188738487 CCGGGGCGGGCCCTTGCGGACCT No data
Right 985323294 4:188738480-188738502 GCGGACCTTCCTCGAGCGCCAGG No data
985323291_985323295 -5 Left 985323291 4:188738465-188738487 CCGGGGCGGGCCCTTGCGGACCT No data
Right 985323295 4:188738483-188738505 GACCTTCCTCGAGCGCCAGGCGG 0: 2
1: 0
2: 0
3: 6
4: 80
985323291_985323301 16 Left 985323291 4:188738465-188738487 CCGGGGCGGGCCCTTGCGGACCT No data
Right 985323301 4:188738504-188738526 GGGGTCTGAAGCCCATTTGAAGG No data
985323291_985323303 24 Left 985323291 4:188738465-188738487 CCGGGGCGGGCCCTTGCGGACCT No data
Right 985323303 4:188738512-188738534 AAGCCCATTTGAAGGTCAGGAGG 0: 3
1: 1
2: 0
3: 11
4: 136
985323291_985323298 -3 Left 985323291 4:188738465-188738487 CCGGGGCGGGCCCTTGCGGACCT No data
Right 985323298 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985323291 Original CRISPR AGGTCCGCAAGGGCCCGCCC CGG (reversed) Intergenic