ID: 985323292

View in Genome Browser
Species Human (GRCh38)
Location 4:188738475-188738497
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323292_985323303 14 Left 985323292 4:188738475-188738497 CCCTTGCGGACCTTCCTCGAGCG No data
Right 985323303 4:188738512-188738534 AAGCCCATTTGAAGGTCAGGAGG No data
985323292_985323301 6 Left 985323292 4:188738475-188738497 CCCTTGCGGACCTTCCTCGAGCG No data
Right 985323301 4:188738504-188738526 GGGGTCTGAAGCCCATTTGAAGG No data
985323292_985323306 27 Left 985323292 4:188738475-188738497 CCCTTGCGGACCTTCCTCGAGCG No data
Right 985323306 4:188738525-188738547 GGTCAGGAGGCCCGAGTTGCTGG No data
985323292_985323307 30 Left 985323292 4:188738475-188738497 CCCTTGCGGACCTTCCTCGAGCG No data
Right 985323307 4:188738528-188738550 CAGGAGGCCCGAGTTGCTGGCGG No data
985323292_985323302 11 Left 985323292 4:188738475-188738497 CCCTTGCGGACCTTCCTCGAGCG No data
Right 985323302 4:188738509-188738531 CTGAAGCCCATTTGAAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985323292 Original CRISPR CGCTCGAGGAAGGTCCGCAA GGG (reversed) Intergenic