ID: 985323293

View in Genome Browser
Species Human (GRCh38)
Location 4:188738476-188738498
Sequence GCGCTCGAGGAAGGTCCGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323293_985323301 5 Left 985323293 4:188738476-188738498 CCTTGCGGACCTTCCTCGAGCGC No data
Right 985323301 4:188738504-188738526 GGGGTCTGAAGCCCATTTGAAGG No data
985323293_985323307 29 Left 985323293 4:188738476-188738498 CCTTGCGGACCTTCCTCGAGCGC No data
Right 985323307 4:188738528-188738550 CAGGAGGCCCGAGTTGCTGGCGG No data
985323293_985323303 13 Left 985323293 4:188738476-188738498 CCTTGCGGACCTTCCTCGAGCGC No data
Right 985323303 4:188738512-188738534 AAGCCCATTTGAAGGTCAGGAGG No data
985323293_985323302 10 Left 985323293 4:188738476-188738498 CCTTGCGGACCTTCCTCGAGCGC No data
Right 985323302 4:188738509-188738531 CTGAAGCCCATTTGAAGGTCAGG No data
985323293_985323306 26 Left 985323293 4:188738476-188738498 CCTTGCGGACCTTCCTCGAGCGC No data
Right 985323306 4:188738525-188738547 GGTCAGGAGGCCCGAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985323293 Original CRISPR GCGCTCGAGGAAGGTCCGCA AGG (reversed) Intergenic