ID: 985323297

View in Genome Browser
Species Human (GRCh38)
Location 4:188738485-188738507
Sequence CCCCGCCTGGCGCTCGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323297_985323303 4 Left 985323297 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
Right 985323303 4:188738512-188738534 AAGCCCATTTGAAGGTCAGGAGG No data
985323297_985323306 17 Left 985323297 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
Right 985323306 4:188738525-188738547 GGTCAGGAGGCCCGAGTTGCTGG No data
985323297_985323307 20 Left 985323297 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
Right 985323307 4:188738528-188738550 CAGGAGGCCCGAGTTGCTGGCGG No data
985323297_985323301 -4 Left 985323297 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
Right 985323301 4:188738504-188738526 GGGGTCTGAAGCCCATTTGAAGG No data
985323297_985323302 1 Left 985323297 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
Right 985323302 4:188738509-188738531 CTGAAGCCCATTTGAAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985323297 Original CRISPR CCCCGCCTGGCGCTCGAGGA AGG (reversed) Intergenic