ID: 985323298

View in Genome Browser
Species Human (GRCh38)
Location 4:188738485-188738507
Sequence CCTTCCTCGAGCGCCAGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323281_985323298 21 Left 985323281 4:188738441-188738463 CCCGCCGCTGGAGAAGCTGTTCG 0: 1
1: 0
2: 2
3: 10
4: 83
Right 985323298 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
985323290_985323298 -2 Left 985323290 4:188738464-188738486 CCCGGGGCGGGCCCTTGCGGACC No data
Right 985323298 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
985323291_985323298 -3 Left 985323291 4:188738465-188738487 CCGGGGCGGGCCCTTGCGGACCT No data
Right 985323298 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
985323282_985323298 20 Left 985323282 4:188738442-188738464 CCGCCGCTGGAGAAGCTGTTCGC 0: 1
1: 0
2: 3
3: 4
4: 45
Right 985323298 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
985323280_985323298 28 Left 985323280 4:188738434-188738456 CCGGTAGCCCGCCGCTGGAGAAG 0: 1
1: 1
2: 1
3: 3
4: 57
Right 985323298 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
985323283_985323298 17 Left 985323283 4:188738445-188738467 CCGCTGGAGAAGCTGTTCGCCCG 0: 1
1: 0
2: 3
3: 3
4: 68
Right 985323298 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985323298 Original CRISPR CCTTCCTCGAGCGCCAGGCG GGG Intergenic