ID: 985323299

View in Genome Browser
Species Human (GRCh38)
Location 4:188738489-188738511
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323299_985323303 0 Left 985323299 4:188738489-188738511 CCTCGAGCGCCAGGCGGGGTCTG No data
Right 985323303 4:188738512-188738534 AAGCCCATTTGAAGGTCAGGAGG 0: 3
1: 1
2: 0
3: 11
4: 136
985323299_985323307 16 Left 985323299 4:188738489-188738511 CCTCGAGCGCCAGGCGGGGTCTG No data
Right 985323307 4:188738528-188738550 CAGGAGGCCCGAGTTGCTGGCGG No data
985323299_985323301 -8 Left 985323299 4:188738489-188738511 CCTCGAGCGCCAGGCGGGGTCTG No data
Right 985323301 4:188738504-188738526 GGGGTCTGAAGCCCATTTGAAGG No data
985323299_985323302 -3 Left 985323299 4:188738489-188738511 CCTCGAGCGCCAGGCGGGGTCTG No data
Right 985323302 4:188738509-188738531 CTGAAGCCCATTTGAAGGTCAGG No data
985323299_985323306 13 Left 985323299 4:188738489-188738511 CCTCGAGCGCCAGGCGGGGTCTG No data
Right 985323306 4:188738525-188738547 GGTCAGGAGGCCCGAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985323299 Original CRISPR CAGACCCCGCCTGGCGCTCG AGG (reversed) Intergenic