ID: 985323300

View in Genome Browser
Species Human (GRCh38)
Location 4:188738498-188738520
Sequence AATGGGCTTCAGACCCCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323300_985323303 -9 Left 985323300 4:188738498-188738520 CCAGGCGGGGTCTGAAGCCCATT No data
Right 985323303 4:188738512-188738534 AAGCCCATTTGAAGGTCAGGAGG 0: 3
1: 1
2: 0
3: 11
4: 136
985323300_985323307 7 Left 985323300 4:188738498-188738520 CCAGGCGGGGTCTGAAGCCCATT No data
Right 985323307 4:188738528-188738550 CAGGAGGCCCGAGTTGCTGGCGG No data
985323300_985323306 4 Left 985323300 4:188738498-188738520 CCAGGCGGGGTCTGAAGCCCATT No data
Right 985323306 4:188738525-188738547 GGTCAGGAGGCCCGAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985323300 Original CRISPR AATGGGCTTCAGACCCCGCC TGG (reversed) Intergenic