ID: 985323301

View in Genome Browser
Species Human (GRCh38)
Location 4:188738504-188738526
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985323299_985323301 -8 Left 985323299 4:188738489-188738511 CCTCGAGCGCCAGGCGGGGTCTG No data
Right 985323301 4:188738504-188738526 GGGGTCTGAAGCCCATTTGAAGG No data
985323291_985323301 16 Left 985323291 4:188738465-188738487 CCGGGGCGGGCCCTTGCGGACCT No data
Right 985323301 4:188738504-188738526 GGGGTCTGAAGCCCATTTGAAGG No data
985323292_985323301 6 Left 985323292 4:188738475-188738497 CCCTTGCGGACCTTCCTCGAGCG No data
Right 985323301 4:188738504-188738526 GGGGTCTGAAGCCCATTTGAAGG No data
985323293_985323301 5 Left 985323293 4:188738476-188738498 CCTTGCGGACCTTCCTCGAGCGC No data
Right 985323301 4:188738504-188738526 GGGGTCTGAAGCCCATTTGAAGG No data
985323290_985323301 17 Left 985323290 4:188738464-188738486 CCCGGGGCGGGCCCTTGCGGACC No data
Right 985323301 4:188738504-188738526 GGGGTCTGAAGCCCATTTGAAGG No data
985323297_985323301 -4 Left 985323297 4:188738485-188738507 CCTTCCTCGAGCGCCAGGCGGGG No data
Right 985323301 4:188738504-188738526 GGGGTCTGAAGCCCATTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type